In contrast, extent of SHM (mutations/100 nucleotides) in IGHM CDRH3 among groups was similar. occurred among all groups, IGHD and IGHJ allele use, CDRH3 length distribution, or generation of SHM were similar among study cohorts. Antiretroviral therapy failed to normalize IGHM biodiversity in HIV-infected individuals. All subjects had a low frequency of allelic combinations within the IGHM repertoire similar to known broadly neutralizing HIV-1 antibodies. Conclusion: Polyclonal expansion would decrease overall IgM biodiversity independent of other mechanisms for development VZ185 Rabbit polyclonal to AMOTL1 of the B cell repertoire. Applying deep sequencing as a strategy to VZ185 follow development of the IgM repertoire in health and disease provides a novel molecular assessment of multiple points along the B cell differentiation pathway that is highly sensitive for detecting perturbations VZ185 within the repertoire at the population level. (Invitrogen) and GoTaq colorless Master Mix (Promega, Madison, WI, USA) from 200?ng mRNA (equivalent to about 100,000 B cells or 80,000 IgM B cells) extracted from total PBMC by MicroPoly[A]Purist? kit (Ambion, Austin, TX, USA). Open in a separate window Figure 1 Amplicon libraries and bioinformatic pipeline. (A) Library construction. IgM specificity was determined by reverse primers sequences specific for IgM constant region without IgM B cell purification. (B) Bioinformatic pipeline. Quality sequences (blue box) were analyzed by querying: (1) customized IGH V-D-J recombination reference sequence database, (2) IMGT/Junction Analysis, (3) ESPRIT (yellow boxes) to generate three reports (pink boxes). Forward inner primer pan VH-FR3 is located in framework 3 and does not overlap CDRH3 (44). Using the software Oligo (Molecular Biology Insights, Inc., Cascade, CO, USA), pan VH-FR3 primer was predicted to bind with similar capacity to a unique sequence in each IGHV family when evaluated against IGHV family specific reference sequences. In contrast, the pan VH-FR1 primer (44) displayed different binding capacity to different IGHV families. Specifically, pan VH-FR1 primer bound preferentially to IGHV3; displayed low binding capacity with IGHV4, IGHV5, and IGHV7; failed to bind to IGHV2 or IGHV6; and bound to VZ185 false priming sites in IGHV1, IGHV4, and IGHV5. To overcome the different binding capacity of the published primer sequence, we designed a modified panVH-FR1* primer (CAGGTGCAGCTGGAGCAGTCTGG_) that was one nucleotide shorter and substituted A and C for T and G in the published primer sequence, respectively. When evaluated by Oligo, the modified panVH-FR1* primer displayed similar binding capacity to each IGHV family reference sequence and no binding to false priming sites. Forward and reverse primers, pan VH-FR3, and C2, in the final amplification were conjugated at 5 ends with A (GCCTCCCTCGCGCCATCAG) or B (GCCTTGCCAGCCCGCTCAG) adaptor, respectively, to generate amplicons ranging from 150 to 200 nucleotides. Gel-purified amplicons were submitted to the Interdisciplinary Center for Biotechnology Research (University of Florida) for 454-pyrosequencing using a Genome Sequencer FLX VZ185 (454 Life Sciences) according to the manufacturers protocol. Bioinformatics pipeline A bioinformatics pipeline was developed to facilitate analysis of large numbers of relatively short IGHM CDRH3 sequences that could not be processed by conventional IMGT/V-QUEST analysis (Figure ?(Figure1B)1B) (45). Raw reads ranged from 4,500 to 21,000 pyrosequences per subject. A quality control step filtered 9C21% low quality reads with ambiguous nucleotides, more than one error in either primer tag, or failure to align to reference sequences in the germ line IGH V-D-J recombination amino acid reference sequence database (see below), leaving 4,000C17,000 quality sequences per sample with no significant difference in number of sequences among the groups (Table ?(Table22). Table 2 Sequence profiles. all possible combinations of germ line IGHV (285 unique aa sequences), IGHD [44 unique nucleotide sequences translated in 6 reading frames (RF) producing 222 aa sequences], and IGHJ (13 unique aa sequences) alleles downloaded from IMGT (45). Each reference sequence was annotated for IGHV, IGHD, and IGHJ allele use, IGHD RF in the header with C104 and W118, the 5 and 3 boarders of CDRH3, marked.
