Seeing that in the case of DEC\20532 and DC\SIGN,33 the generation of LSECtin\specific reagent will be a very useful tool to evaluate its potential role as a tolerance\promoting capturing receptor. interfering RNA led to a decrease in LSECtin mRNA levels in THP\1 and monocyte\derived dendritic cells, thus confirming the involvement of PU.1 in the myeloid expression of the lectin. LSECtin is usually expressed by liver myeloid cells, and its expression is dependent around the PU.1 transcription factor. (Hepatology 2009;49:287C296.) The gene cluster at chromosome 19p13.2 includes the genes encoding for the type II C\type lectins DC\SIGN, L\SIGN, CD23, and LSECtin,1, 2, 3, 4 all of which contain a single carbohydrate\recognition domain name followed by a stalk domain name, a transmembrane region, and a cytoplasmic tail containing various internalization motifs. DC\SIGN, L\SIGN, and LSECtin function as endocytic receptors and mediate binding and internalization of clinically relevant viral, bacterial, and fungal pathogens.5, 6 CD23 is expressed on myeloid cells and activated B lymphocytes, where it functions as a low affinity receptor for immunoglobulin E and plays a role in limiting the extent of immunoglobulin ECmediated pathologies.7, 8 DC\SIGN is expressed on myeloid dendritic cells (DCs),1, 9 alternatively activated macrophages,10 interstitial JNK-IN-8 DCs,11 a subset of CD14+ peripheral blood DCs,12 and macrophages from various tissues,13, 14, 15 whereas L\SIGN is exclusively expressed on endothelial cells of the liver, lymph nodes, and placenta.16, 17 Although reported to be exclusively JNK-IN-8 expressed on liver and lymph node sinusoidal endothelial cells,4 LSECtin has been later found to be expressed in isolated human peripheral blood and thymic DCs, as well as in DCs and alternatively activated macrophages generated to the human LSECtin proximal promoter, and PU.1 protein levels determine the extent of LSECtin messenger RNA (mRNA) expression. Therefore, PU.1 contributes to the myeloid expression of LSECtin, which constitutes a novel addition to the arsenal of scavenging molecules expressed by liver Kupffer cells. Abbreviations DC, dendritic cell; GAPDH, glyceraldehyde 3\phosphate dehydrogenase; IL\4, interleukin\4; LSECtin, liver and lymph node sinusoidal endothelial cell C\type lectin; MDDC, monocyte\derived dendritic cell; mRNA, messenger RNA; PCR, polymerase chain reaction; PPAR, peroxisome proliferator\activated receptor gamma; RT\PCR, reverse\transcription polymerase chain reaction; siRNA, small interfering RNA. Materials and Methods Cell Culture, Transfection, and Site\Directed Mutagenesis. Monocytes were purified from peripheral blood mononuclear cells via magnetic cell sorting using CD14 microbeads (Miltenyi PEBP2A2 Biotech, Bergisch Gladbach, Germany), and monocyte\derived dendritic cells (MDDCs) were generated as described.5, 6 The K562 (chronic myelogenous leukemia) and THP\1 (monocytic leukemia) cell lines were cultured in Roswell Park Memorial Institute 1640 medium supplemented with 10% fetal bovine serum, 25 mM 4\(2\hydroxyethyl)\1\piperazine ethanesulfonic acid, and 2 mM glutamine (complete medium), at 37C in a humidified atmosphere with 5% CO2. MUTZ\3 cells23, 24, 25 were maintained in complete medium supplemented with granulocyte\macrophage colony\stimulating factor (10 ng/mL) and their dendritic differentiation was induced in JNK-IN-8 the presence of 1,000 U/mL interleukin\4 (IL\4) for 5 days. Transfection of NIH\3T3, Jurkat, K562, and THP\1 cells were performed as described using Superfect (Qiagen, Hilden, Germany) or DEAE\Dextran.26 In reporter gene experiments, the amount of DNA in each transfection was normalized by using the corresponding insertless expression vector (CMV\0) as a carrier. Each transfection experiment was performed at least three times with different DNA preparations. Transfection efficiencies were normalized via cotransfection with the pCMV\gal plasmid, and \galactosidase levels were decided using the Galacto\Light kit (Tropix, Bedford, MA). The LSECtin\based reporter gene constructs pCLEC4G\591, pCLEC4G\296, and pCLEC4G\247 were generated via polymerase chain reaction (PCR) amplification of the \591/+16, ?296/+16 and ?247/+16 fragments of the LSECtin promoter with oligonucleotides 5\CCAAGCTTGGAAAACTAAGGCTTCTAGAAGC\3, 5\CCAAGCTTGGTGACTAA GCTCCAAAGAGAAG\3, and 5\GGGGTACCCGATGCAGGCACCCAGTCC\3, and the resulting fragments cloned into HindIII and KpnI\digested pXP2 plasmid.27 Positions within the LSECtin regulatory regions were numbered from the predicted transcriptional start site. The PU.1 expression plasmids for human PU.1, RUNX3, and Myb have been described.26 THP\1 cells or MDDCs (2 106 cells) were nucleofected with 3 g of small interfering RNA (siRNA) for PU.1 ( 10?4), while mutation of the putative Ets\binding site at ?99 did not affect LSECtin proximal promoter activity (Fig. ?(Fig.5C).5C). These results indicate that this preferential activity of the LSECtin gene regulatory region in myeloid cells is usually partly dependent on the integrity of the sequence around ?66, which includes three potential binding sites for Ets family members. Open in a separate window Physique 5 Structural and functional analysis of the LSECtin gene proximal regulatory region. (A) Sequence alignment of the proximal regulatory regions (from ?350 to the translation initiation site) of the.
